Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCCACTGCCCGCTCTGCTGTTT[A/C]TCTGCCTGCATGCTGTCTGCCCTTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602243 MIM: 614177 MIM: 609059 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CD151 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CD151 - CD151 molecule (Raph blood group) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CRACR2B - calcium release activated channel regulator 2B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286606.1 | Intron | NP_001273535.1 | ||||
NM_173584.4 | Intron | NP_775855.3 | ||||
XM_011520011.1 | Intron | XP_011518313.1 | ||||
XM_011520019.1 | Intron | XP_011518321.1 | ||||
XM_017017581.1 | Intron | XP_016873070.1 | ||||
XM_017017582.1 | Intron | XP_016873071.1 | ||||
XM_017017583.1 | Intron | XP_016873072.1 | ||||
XM_017017584.1 | Intron | XP_016873073.1 | ||||
XM_017017585.1 | Intron | XP_016873074.1 | ||||
XM_017017586.1 | Intron | XP_016873075.1 | ||||
XM_017017587.1 | Intron | XP_016873076.1 | ||||
XM_017017588.1 | Intron | XP_016873077.1 | ||||
XM_017017589.1 | Intron | XP_016873078.1 | ||||
XM_017017590.1 | Intron | XP_016873079.1 | ||||
XM_017017591.1 | Intron | XP_016873080.1 | ||||
XM_017017592.1 | Intron | XP_016873081.1 | ||||
XM_017017593.1 | Intron | XP_016873082.1 | ||||
XM_017017594.1 | Intron | XP_016873083.1 | ||||
XM_017017595.1 | Intron | XP_016873084.1 | ||||
XM_017017596.1 | Intron | XP_016873085.1 | ||||
XM_017017597.1 | Intron | XP_016873086.1 | ||||
XM_017017598.1 | Intron | XP_016873087.1 | ||||
XM_017017599.1 | Intron | XP_016873088.1 |
PNPLA2 - patatin like phospholipase domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |