Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGGGCGGGGGGTTTCCTTTCCCC[G/T]CAGGGCTGGGGGTCCGCTGTTTCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601519 MIM: 160782 MIM: 180072 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATP5I PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATP5I - ATP synthase, H+ transporting, mitochondrial Fo complex subunit E | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007100.3 | 352 | Intron | NP_009031.1 |
MFSD7 - major facilitator superfamily domain containing 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYL5 - myosin light chain 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002477.1 | 352 | Intron | NP_002468.1 | |||
XM_006713886.2 | 352 | Missense Mutation | CGC,CTC | R,L 112 | XP_006713949.1 | |
XM_017008245.1 | 352 | UTR 5 | XP_016863734.1 | |||
XM_017008246.1 | 352 | UTR 5 | XP_016863735.1 | |||
XM_017008247.1 | 352 | Intron | XP_016863736.1 | |||
XM_017008248.1 | 352 | Intron | XP_016863737.1 |
PDE6B - phosphodiesterase 6B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |