Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAGGCGGTTGTGCGAGACGTCCA[A/G]CCAGAAGGCCCGCTGCAGGGGGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601489 MIM: 610779 MIM: 611659 | ||||||||||||||||||||
Literature Links: |
IGFALS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IGFALS - insulin like growth factor binding protein acid labile subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146006.1 | 1654 | Silent Mutation | CTG,TTG | L,L 525 | NP_001139478.1 | |
NM_004970.2 | 1654 | Silent Mutation | CTG,TTG | L,L 487 | NP_004961.1 |
NUBP2 - nucleotide binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPSB3 - splA/ryanodine receptor domain and SOCS box containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |