Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCAGCCGCAGCGCTCGGCTTTCCC[C/G]GGCCCATCCGCCGCCTTGCGCACGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612184 MIM: 612190 MIM: 172280 | ||||||||||||||||||||
Literature Links: |
BRICD5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BRICD5 - BRICHOS domain containing 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CASKIN1 - CASK interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MLST8 - MTOR associated protein, LST8 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001199173.1 | 180 | Intron | NP_001186102.1 | |||
NM_001199174.1 | 180 | Intron | NP_001186103.1 | |||
NM_001199175.1 | 180 | Intron | NP_001186104.1 | |||
NM_022372.4 | 180 | Intron | NP_071767.3 | |||
XM_005255475.3 | 180 | Intron | XP_005255532.2 | |||
XM_005255478.2 | 180 | Intron | XP_005255535.1 | |||
XM_005255479.2 | 180 | Intron | XP_005255536.1 | |||
XM_017023548.1 | 180 | Intron | XP_016879037.1 | |||
XM_017023549.1 | 180 | Intron | XP_016879038.1 | |||
XM_017023550.1 | 180 | Missense Mutation | CCG,CGG | P,R 10 | XP_016879039.1 | |
XM_017023551.1 | 180 | Intron | XP_016879040.1 | |||
XM_017023552.1 | 180 | Missense Mutation | CCG,CGG | P,R 10 | XP_016879041.1 |
PGP - phosphoglycolate phosphatase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |