Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTCCCAGTGGAGGCCCGTGTCCCA[A/G]CAGCGGCCCACACCCAGCAATTGCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601615 | ||||||||||||||||||||
Literature Links: |
ABCA3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCA3 - ATP binding cassette subfamily A member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001089.2 | Intron | NP_001080.2 |
LOC106660606 - uncharacterized LOC106660606 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3677 - microRNA 3677 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4717 - microRNA 4717 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR940 - microRNA 940 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |