Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCAGAGTGCGGCTAGCTCAGCCC[A/G]GAGACTTTTTGGGGGGACAGGGTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614534 MIM: 607996 MIM: 602679 MIM: 606212 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANAPC11 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANAPC11 - anaphase promoting complex subunit 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPB - neuropeptide B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCYT2 - phosphate cytidylyltransferase 2, ethanolamine | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184917.2 | Intron | NP_001171846.1 | ||||
NM_001256433.2 | Intron | NP_001243362.1 | ||||
NM_001256434.2 | Intron | NP_001243363.1 | ||||
NM_001256435.2 | Intron | NP_001243364.1 | ||||
NM_001282203.1 | Intron | NP_001269132.1 | ||||
NM_001282204.1 | Intron | NP_001269133.1 | ||||
NM_002861.4 | Intron | NP_002852.1 | ||||
XM_005256386.3 | Intron | XP_005256443.1 | ||||
XM_005256387.3 | Intron | XP_005256444.1 | ||||
XM_006722287.3 | Intron | XP_006722350.1 | ||||
XM_017024910.1 | Intron | XP_016880399.1 | ||||
XM_017024911.1 | Intron | XP_016880400.1 | ||||
XM_017024912.1 | Intron | XP_016880401.1 |
SIRT7 - sirtuin 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |