Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAGAAAATCTTTGATGCTTTTAGG[G/T]ATAAGACAGATGCCCAGGTGAGTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611927 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC166 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC166 - coiled-coil domain containing 166 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM83H - family with sequence similarity 83 member H | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928160 - uncharacterized LOC101928160 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAPK15 - mitogen-activated protein kinase 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_139021.2 | 970 | Missense Mutation | GAT,TAT | D,Y 50 | NP_620590.2 | |
XM_011516925.2 | 970 | Missense Mutation | GAT,TAT | D,Y 52 | XP_011515227.1 | |
XM_011516926.2 | 970 | Missense Mutation | GAT,TAT | D,Y 50 | XP_011515228.1 | |
XM_011516927.2 | 970 | Missense Mutation | GAT,TAT | D,Y 52 | XP_011515229.1 | |
XM_011516928.2 | 970 | Missense Mutation | GAT,TAT | D,Y 52 | XP_011515230.1 | |
XM_017013218.1 | 970 | Missense Mutation | GAT,TAT | D,Y 52 | XP_016868707.1 |