Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCGCATCGTCTCCAGAGGTAGGAC[C/G]CAGCTTTTTGCCCTGAACCCGCGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606288 MIM: 606289 MIM: 606290 MIM: 606291 MIM: 606292 MIM: 606293 MIM: 606299 MIM: 606300 MIM: 606301 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PCDHGA1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PCDHGA1 - protocadherin gamma subfamily A, 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018912.2 | 216 | Intron | NP_061735.1 | |||
NM_031993.1 | 216 | Intron | NP_114382.1 |
PCDHGA2 - protocadherin gamma subfamily A, 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018915.3 | 216 | Intron | NP_061738.1 | |||
NM_032009.2 | 216 | Intron | NP_114398.1 |
PCDHGA3 - protocadherin gamma subfamily A, 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018916.3 | 216 | Intron | NP_061739.2 | |||
NM_032011.1 | 216 | Intron | NP_114400.1 |
PCDHGA4 - protocadherin gamma subfamily A, 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018917.3 | 216 | Intron | NP_061740.2 | |||
NM_032053.2 | 216 | Intron | NP_114442.2 |
PCDHGA5 - protocadherin gamma subfamily A, 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018918.2 | 216 | Silent Mutation | ACC,ACG | T,T 72 | NP_061741.1 | |
NM_032054.1 | 216 | Silent Mutation | ACC,ACG | T,T 72 | NP_114443.1 |
PCDHGA6 - protocadherin gamma subfamily A, 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PCDHGB1 - protocadherin gamma subfamily B, 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018922.2 | 216 | Intron | NP_061745.1 | |||
NM_032095.1 | 216 | Intron | NP_115266.1 |
PCDHGB2 - protocadherin gamma subfamily B, 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_018923.2 | 216 | Intron | NP_061746.1 | |||
NM_032096.1 | 216 | Intron | NP_115267.1 |
PCDHGB3 - protocadherin gamma subfamily B, 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |