Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCAGCCAAGGTCACAGAGGGAGTGA[C/T]AGCTTCCGCGCAGCCCTGGCTACGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603811 MIM: 601891 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BANF1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BANF1 - barrier to autointegration factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001143985.1 | 347 | Intron | NP_001137457.1 | |||
NM_003860.3 | 347 | Intron | NP_003851.1 | |||
XM_017018514.1 | 347 | UTR 5 | XP_016874003.1 | |||
XM_017018515.1 | 347 | Intron | XP_016874004.1 |
CST6 - cystatin E/M | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF1AD - eukaryotic translation initiation factor 1A domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242481.1 | 347 | Intron | NP_001229410.1 | |||
NM_001242482.1 | 347 | Intron | NP_001229411.1 | |||
NM_001242483.1 | 347 | Intron | NP_001229412.1 | |||
NM_001242484.1 | 347 | Intron | NP_001229413.1 | |||
NM_001242485.1 | 347 | Intron | NP_001229414.1 | |||
NM_001242486.1 | 347 | Intron | NP_001229415.1 | |||
NM_032325.3 | 347 | Intron | NP_115701.2 | |||
XM_017018412.1 | 347 | Intron | XP_016873901.1 |