Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTACTAGAAGCATCAGCTTTTACCA[A/G]TCAGTACAGAAAAATTAATATTTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606374 MIM: 603947 MIM: 180721 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
B3GAT3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
B3GAT3 - beta-1,3-glucuronyltransferase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EML3 - echinoderm microtubule associated protein like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300793.1 | Intron | NP_001287722.1 | ||||
NM_001300794.1 | Intron | NP_001287723.1 | ||||
NM_153265.2 | Intron | NP_694997.2 | ||||
XM_005273878.3 | Intron | XP_005273935.1 | ||||
XM_006718489.3 | Intron | XP_006718552.1 | ||||
XM_006718490.3 | Intron | XP_006718553.1 | ||||
XM_006718491.3 | Intron | XP_006718554.1 | ||||
XM_011544896.2 | Intron | XP_011543198.1 | ||||
XM_011544897.2 | Intron | XP_011543199.1 | ||||
XM_017017480.1 | Intron | XP_016872969.1 | ||||
XM_017017481.1 | Intron | XP_016872970.1 | ||||
XM_017017482.1 | Intron | XP_016872971.1 | ||||
XM_017017483.1 | Intron | XP_016872972.1 |
MTA2 - metastasis associated 1 family member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ROM1 - retinal outer segment membrane protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |