Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTACAGAGGAGGGCCAGGGCCCC[A/G]AAGGTGTCTGGGGACCTTGGGTCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
27 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610113 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ADAMTSL4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ADAMTSL4 - ADAMTS like 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288607.1 | 378 | Missense Mutation | AAA,GAA | K,E 44 | NP_001275536.1 | |
NM_001288608.1 | 378 | Missense Mutation | AAA,GAA | K,E 44 | NP_001275537.1 | |
NM_019032.5 | 378 | Missense Mutation | AAA,GAA | K,E 44 | NP_061905.2 | |
NM_025008.4 | 378 | Missense Mutation | AAA,GAA | K,E 44 | NP_079284.2 | |
XM_011509644.2 | 378 | Missense Mutation | AAA,GAA | K,E 77 | XP_011507946.1 | |
XM_011509645.2 | 378 | Missense Mutation | AAA,GAA | K,E 77 | XP_011507947.1 | |
XM_011509648.2 | 378 | Missense Mutation | AAA,GAA | K,E 44 | XP_011507950.1 | |
XM_011509649.2 | 378 | Missense Mutation | AAA,GAA | K,E 77 | XP_011507951.1 | |
XM_011509650.2 | 378 | Missense Mutation | AAA,GAA | K,E 77 | XP_011507952.1 | |
XM_011509651.2 | 378 | Intron | XP_011507953.1 | |||
XM_011509652.1 | 378 | Intron | XP_011507954.1 | |||
XM_017001506.1 | 378 | Missense Mutation | AAA,GAA | K,E 44 | XP_016856995.1 | |
XM_017001507.1 | 378 | Intron | XP_016856996.1 |
ADAMTSL4-AS1 - ADAMTSL4 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100289061 - uncharacterized LOC100289061 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107983947 - uncharacterized LOC107983947 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR4257 - microRNA 4257 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |