Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAAGCTGAAGGTTTAGTCACCCCC[A/G]TGAGTTTAAGATAATAACATATTTA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 611177 MIM: 605575 | |||||||||||||||||||||||
Literature Links: |
IFT80 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
IFT80 - intraflagellar transport 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR15B - microRNA 15b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR16-2 - microRNA 16-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMC4 - structural maintenance of chromosomes 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002800.2 | Intron | NP_001002800.1 | ||||
NM_001288753.1 | Intron | NP_001275682.1 | ||||
NM_005496.3 | Intron | NP_005487.3 | ||||
XM_006713459.3 | Intron | XP_006713522.1 | ||||
XM_011512311.2 | Intron | XP_011510613.1 | ||||
XM_011512312.2 | Intron | XP_011510614.1 | ||||
XM_017005491.1 | Intron | XP_016860980.1 |