Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATTCTCGGGTTGATCACAGTGTC[C/T]TTGGGGTGCTCTGGGGAAAGTTGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604722 MIM: 608052 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SH2D3C PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SH2D3C - SH2 domain containing 3C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142531.1 | 2313 | UTR 3 | NP_001136003.1 | |||
NM_001142532.1 | 2313 | UTR 3 | NP_001136004.1 | |||
NM_001142533.1 | 2313 | UTR 3 | NP_001136005.1 | |||
NM_001142534.1 | 2313 | UTR 3 | NP_001136006.1 | |||
NM_001252334.1 | 2313 | UTR 3 | NP_001239263.1 | |||
NM_005489.3 | 2313 | UTR 3 | NP_005480.2 | |||
NM_170600.2 | 2313 | UTR 3 | NP_733745.1 | |||
XM_005251639.1 | 2313 | UTR 3 | XP_005251696.1 | |||
XM_011518114.1 | 2313 | UTR 3 | XP_011516416.1 | |||
XM_011518115.1 | 2313 | UTR 3 | XP_011516417.1 | |||
XM_011518117.2 | 2313 | UTR 3 | XP_011516419.1 | |||
XM_017014174.1 | 2313 | UTR 3 | XP_016869663.1 |
TOR2A - torsin family 2 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC16 - tetratricopeptide repeat domain 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |