Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGACCTCTCAGTCGAGGCTGGGTCT[A/C]TAATATACCTTTCTCTATTAGCCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608846 MIM: 602950 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ADM5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ADM5 - adrenomedullin 5 (putative) | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001101340.1 | 1747 | UTR 3 | NP_001094810.1 |
CPT1C - carnitine palmitoyltransferase 1C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136052.2 | 1747 | Intron | NP_001129524.1 | |||
NM_001199752.2 | 1747 | Intron | NP_001186681.1 | |||
NM_001199753.1 | 1747 | Intron | NP_001186682.1 | |||
NM_152359.2 | 1747 | Intron | NP_689572.1 | |||
XM_005258505.2 | 1747 | Intron | XP_005258562.1 | |||
XM_005258506.4 | 1747 | Intron | XP_005258563.1 | |||
XM_006723009.3 | 1747 | Intron | XP_006723072.1 | |||
XM_011526438.2 | 1747 | Intron | XP_011524740.1 | |||
XM_011526439.2 | 1747 | Intron | XP_011524741.1 | |||
XM_011526440.2 | 1747 | Intron | XP_011524742.1 | |||
XM_017026265.1 | 1747 | Intron | XP_016881754.1 | |||
XM_017026266.1 | 1747 | Intron | XP_016881755.1 | |||
XM_017026267.1 | 1747 | Intron | XP_016881756.1 | |||
XM_017026268.1 | 1747 | Intron | XP_016881757.1 | |||
XM_017026269.1 | 1747 | Intron | XP_016881758.1 | |||
XM_017026270.1 | 1747 | Intron | XP_016881759.1 | |||
XM_017026271.1 | 1747 | Intron | XP_016881760.1 | |||
XM_017026272.1 | 1747 | Intron | XP_016881761.1 | |||
XM_017026273.1 | 1747 | Intron | XP_016881762.1 |
MIR5088 - microRNA 5088 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRMT1 - protein arginine methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |