Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGGCATAGAGCCGGCTTCTCCAG[C/T]TTGGGTGAGCGTCCTTTCCAGGCGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602548 MIM: 605071 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LKAAEAR1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LKAAEAR1 - LKAAEAR motif containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007125.1 | 826 | Intron | NP_001007126.1 | |||
XM_005260200.3 | 826 | Intron | XP_005260257.3 |
MIR6813 - microRNA 6813 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OPRL1 - opioid related nociceptin receptor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000913.5 | 826 | Intron | NP_000904.1 | |||
NM_001200019.1 | 826 | UTR 5 | NP_001186948.1 | |||
NM_001318853.1 | 826 | Intron | NP_001305782.1 | |||
NM_001318854.1 | 826 | Intron | NP_001305783.1 | |||
NM_001318855.1 | 826 | Intron | NP_001305784.1 | |||
NM_182647.3 | 826 | Intron | NP_872588.1 | |||
XM_011528828.2 | 826 | UTR 5 | XP_011527130.1 | |||
XM_011528830.2 | 826 | UTR 5 | XP_011527132.1 | |||
XM_017027852.1 | 826 | Intron | XP_016883341.1 | |||
XM_017027853.1 | 826 | Intron | XP_016883342.1 | |||
XM_017027854.1 | 826 | Intron | XP_016883343.1 | |||
XM_017027855.1 | 826 | Intron | XP_016883344.1 |
RGS19 - regulator of G-protein signaling 19 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |