Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAAACTGTCCAGAAGGGAATGGCT[C/G]ATGTCTTTATTCTGAGGGTGAGAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609030 MIM: 601180 MIM: 611151 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DGCR8 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DGCR8 - DGCR8 microprocessor complex subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001190326.1 | 2808 | Intron | NP_001177255.1 | |||
NM_022720.6 | 2808 | Intron | NP_073557.3 | |||
XM_006724268.2 | 2808 | Intron | XP_006724331.1 |
MIR6816 - microRNA 6816 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RANBP1 - RAN binding protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRMT2A - tRNA methyltransferase 2 homolog A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001257994.1 | 2808 | UTR 3 | NP_001244923.1 | |||
NM_022727.5 | 2808 | UTR 3 | NP_073564.3 | |||
NM_182984.4 | 2808 | UTR 3 | NP_892029.2 | |||
XM_011530139.2 | 2808 | UTR 3 | XP_011528441.1 | |||
XM_011530141.1 | 2808 | UTR 3 | XP_011528443.1 | |||
XM_011530142.2 | 2808 | UTR 3 | XP_011528444.1 | |||
XM_017028770.1 | 2808 | UTR 3 | XP_016884259.1 |