Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGAGGTGGACCCACTGCCCTTCC[A/C]GGGCCCCTTCCCTGCTGGGCCCCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601998 MIM: 606583 | ||||||||||||||||||||
Literature Links: |
ESRRA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ESRRA - estrogen related receptor alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001282450.1 | 739 | Intron | NP_001269379.1 | |||
NM_001282451.1 | 739 | Missense Mutation | CAG,CCG | Q,P 173 | NP_001269380.1 | |
NM_004451.4 | 739 | Missense Mutation | CAG,CCG | Q,P 173 | NP_004442.3 | |
XM_017017313.1 | 739 | Missense Mutation | CAG,CCG | Q,P 183 | XP_016872802.1 |
KCNK4-TEX40 - KCNK4-TEX40 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRDX5 - peroxiredoxin 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX40 - testis expressed 40 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRMT112 - tRNA methyltransferase 11-2 homolog (S. cerevisiae) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |