Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCTGATCCTCATAGTGTATGGTAG[A/G]AGCTACTAGGCCCCTTTACATATGA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||
Literature Links: |
EFCAB12 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
EFCAB12 - EF-hand calcium binding domain 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_207307.2 | Intron | NP_997190.1 | ||||
XM_011513293.2 | Intron | XP_011511595.1 | ||||
XM_011513294.2 | Intron | XP_011511596.1 | ||||
XM_011513295.2 | Intron | XP_011511597.1 | ||||
XM_011513297.2 | Intron | XP_011511599.1 | ||||
XM_011513298.1 | Intron | XP_011511600.1 | ||||
XM_011513299.2 | Intron | XP_011511601.1 |
RPL32P3 - ribosomal protein L32 pseudogene 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA7B - small nucleolar RNA, H/ACA box 7B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |