Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATTGCCTACTATGATACTAGTGA[C/T]TCCACTATCCACTTCATGCCAGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602872 MIM: 603382 | ||||||||||||||||||||
Literature Links: |
CLIC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLIC1 - chloride intracellular channel 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSH5 - mutS homolog 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002441.4 | 338 | Silent Mutation | GAC,GAT | D,D 70 | NP_002432.1 | |
NM_025259.5 | 338 | Silent Mutation | GAC,GAT | D,D 70 | NP_079535.4 | |
NM_172165.3 | 338 | Silent Mutation | GAC,GAT | D,D 70 | NP_751897.1 | |
NM_172166.3 | 338 | Silent Mutation | GAC,GAT | D,D 70 | NP_751898.1 |
MSH5-SAPCD1 - MSH5-SAPCD1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |