Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTCATCGGCACTCTGAACGCGGC[C/T]AAGGTGCCGGCCGACACCGGTAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611658 MIM: 190450 MIM: 601447 | ||||||||||||||||||||
Literature Links: |
LOC105369632 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC105369632 - uncharacterized LOC105369632 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPSB2 - splA/ryanodine receptor domain and SOCS box containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TPI1 - triosephosphate isomerase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000365.5 | 243 | Silent Mutation | GCC,GCT | A,A 32 | NP_000356.1 | |
NM_001159287.1 | 243 | Silent Mutation | GCC,GCT | A,A 69 | NP_001152759.1 | |
NM_001258026.1 | 243 | Intron | NP_001244955.1 |
USP5 - ubiquitin specific peptidase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |