Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAATCCTTCATACAGTCATGCACT[A/G]CATAATGATGTTTCAGTTAACGACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603484 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PRC1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PRC1 - protein regulator of cytokinesis 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267580.1 | Intron | NP_001254509.1 | ||||
NM_003981.3 | Intron | NP_003972.1 | ||||
NM_199413.2 | Intron | NP_955445.1 | ||||
XM_005254987.2 | Intron | XP_005255044.1 | ||||
XM_006720759.1 | Intron | XP_006720822.1 | ||||
XM_006720760.1 | Intron | XP_006720823.1 | ||||
XM_011522187.1 | Intron | XP_011520489.1 | ||||
XM_011522188.2 | Intron | XP_011520490.1 | ||||
XM_011522189.1 | Intron | XP_011520491.1 | ||||
XM_011522190.2 | Intron | XP_011520492.1 | ||||
XM_011522191.2 | Intron | XP_011520493.1 | ||||
XM_011522192.1 | Intron | XP_011520494.1 | ||||
XM_017022712.1 | Intron | XP_016878201.1 | ||||
XM_017022713.1 | Intron | XP_016878202.1 | ||||
XM_017022714.1 | Intron | XP_016878203.1 | ||||
XM_017022715.1 | Intron | XP_016878204.1 | ||||
XM_017022716.1 | Intron | XP_016878205.1 | ||||
XM_017022717.1 | Intron | XP_016878206.1 |
PRC1-AS1 - PRC1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RCCD1 - RCC1 domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |