Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CACGGGCAACAGCTAGGCTGCTGTT[A/G]TTTCGCAAGGCAGAAGAGAAAAGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604567 MIM: 603365 MIM: 613199 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DOC2A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DOC2A - double C2 domain alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HIRIP3 - HIRA interacting protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001197323.1 | 155 | UTR 5 | NP_001184252.1 | |||
NM_003609.4 | 155 | UTR 5 | NP_003600.2 |
INO80E - INO80 complex subunit E | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304562.1 | 155 | Intron | NP_001291491.1 | |||
NM_001304563.1 | 155 | Intron | NP_001291492.1 | |||
NM_173618.2 | 155 | Intron | NP_775889.1 | |||
XM_011545809.2 | 155 | Intron | XP_011544111.1 | |||
XM_011545811.2 | 155 | Intron | XP_011544113.1 | |||
XM_011545812.2 | 155 | Intron | XP_011544114.1 | |||
XM_017023169.1 | 155 | Intron | XP_016878658.1 |
TAOK2 - TAO kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |