Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTGAAAAAGAGGACGTGGACAGG[G/T]ATGGTGCTGATGTGCCAGATGGCAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611801 MIM: 171190 MIM: 607048 MIM: 604488 | ||||||||||||||||||||
Literature Links: |
PGAP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PGAP3 - post-GPI attachment to proteins 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001291726.1 | 779 | Silent Mutation | ATA,ATC | I,I 241 | NP_001278655.1 | |
NM_001291728.1 | 779 | Silent Mutation | ATA,ATC | I,I 271 | NP_001278657.1 | |
NM_001291730.1 | 779 | Intron | NP_001278659.1 | |||
NM_001291732.1 | 779 | Intron | NP_001278661.1 | |||
NM_001291733.1 | 779 | Intron | NP_001278662.1 | |||
NM_033419.4 | 779 | Silent Mutation | ATA,ATC | I,I 292 | NP_219487.3 | |
XM_011525480.2 | 779 | Intron | XP_011523782.1 | |||
XM_011525481.2 | 779 | Silent Mutation | ATA,ATC | I,I 177 | XP_011523783.1 |
PNMT - phenylethanolamine N-methyltransferase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STARD3 - StAR related lipid transfer domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TCAP - titin-cap | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |