Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCAATCATCTACTCTGTTCACACC[A/G]TGACAACCTTAATTCCGATACTCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614394 MIM: 612912 MIM: 191161 | ||||||||||||||||||||
Literature Links: |
IFT20 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
IFT20 - intraflagellar transport 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM97 - transmembrane protein 97 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014573.2 | 516 | Missense Mutation | ATG,GTG | M,V 108 | NP_055388.2 | |
XM_005257965.3 | 516 | Missense Mutation | ATG,GTG | M,V 147 | XP_005258022.1 |
TNFAIP1 - TNF alpha induced protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |