Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTATCTCACGATGGTCTGCGGATG[A/T]CCCTGTGGGAATGGCGACAATGCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600007 MIM: 611114 MIM: 180471 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FLT3LG PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FLT3LG - fms related tyrosine kinase 3 ligand | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR150 - microRNA 150 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL13A - ribosomal protein L13a | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270491.1 | Intron | NP_001257420.1 | ||||
NM_012423.3 | Intron | NP_036555.1 |
RPS11 - ribosomal protein S11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD32A - small nucleolar RNA, C/D box 32A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD33 - small nucleolar RNA, C/D box 33 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD34 - small nucleolar RNA, C/D box 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35A - small nucleolar RNA, C/D box 35A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD35B - small nucleolar RNA, C/D box 35B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |