Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGGGAACAGCCTGGGACACTCA[A/C]CATCTGTACTCTCGGGGTCTGACTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610221 MIM: 605610 MIM: 616659 | ||||||||||||||||||||
Literature Links: |
AKT1S1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AKT1S1 - AKT1 substrate 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001098632.2 | Intron | NP_001092102.1 | ||||
NM_001098633.3 | Intron | NP_001092103.1 | ||||
NM_001278159.1 | Intron | NP_001265088.1 | ||||
NM_001278160.1 | Intron | NP_001265089.1 | ||||
NM_032375.5 | Intron | NP_115751.3 |
PNKP - polynucleotide kinase 3'-phosphatase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBC1D17 - TBC1 domain family member 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |