Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGCTATTGAAACATGAAGGATCA[C/G]TTTCCTCGGAGCTCTGGGAACCCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600284 MIM: 611670 MIM: 607391 | ||||||||||||||||||||
Literature Links: |
ELL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ELL - elongation factor for RNA polymerase II | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006532.3 | 2613 | UTR 3 | NP_006523.1 | |||
XM_011528330.2 | 2613 | Intron | XP_011526632.2 | |||
XM_017027335.1 | 2613 | UTR 3 | XP_016882824.1 | |||
XM_017027336.1 | 2613 | UTR 3 | XP_016882825.1 | |||
XM_017027337.1 | 2613 | UTR 3 | XP_016882826.1 |
ISYNA1 - inositol-3-phosphate synthase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSBP4 - single stranded DNA binding protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |