Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCATTTTGATAGGTCCGAGTCGGC[C/T]GGTTGTTCTGGCTCCTGTGACCTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
12 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
ATXN7L2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ATXN7L2 - ataxin 7 like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_153340.4 | Intron | NP_699171.3 | ||||
XM_005270445.3 | Intron | XP_005270502.1 | ||||
XM_005270446.2 | Intron | XP_005270503.1 | ||||
XM_011540638.2 | Intron | XP_011538940.1 | ||||
XM_011540639.2 | Intron | XP_011538941.1 | ||||
XM_011540641.2 | Intron | XP_011538943.1 | ||||
XM_011540644.2 | Intron | XP_011538946.1 | ||||
XM_011540645.1 | Intron | XP_011538947.1 | ||||
XM_011540646.2 | Intron | XP_011538948.1 | ||||
XM_017000267.1 | Intron | XP_016855756.1 | ||||
XM_017000268.1 | Intron | XP_016855757.1 | ||||
XM_017000269.1 | Intron | XP_016855758.1 | ||||
XM_017000270.1 | Intron | XP_016855759.1 |
CYB561D1 - cytochrome b561 family member D1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYPL2 - synaptophysin like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |