Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAACAATACTGCTTAAGTAGCTAA[C/T]AAATAAAGGTAGGCTGTACATAGAC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 614948 | |||||||||||||||||||||||
Literature Links: |
TAMM41 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
TAMM41 - TAM41 mitochondrial translocator assembly and maintenance homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284401.1 | Intron | NP_001271330.1 | ||||
NM_001321294.1 | Intron | NP_001308223.1 | ||||
NM_001321295.1 | Intron | NP_001308224.1 | ||||
NM_138807.3 | Intron | NP_620162.1 | ||||
XM_005264873.3 | Intron | XP_005264930.1 | ||||
XM_005264875.3 | Intron | XP_005264932.1 | ||||
XM_017005725.1 | Intron | XP_016861214.1 | ||||
XM_017005726.1 | Intron | XP_016861215.1 | ||||
XM_017005727.1 | Intron | XP_016861216.1 | ||||
XM_017005728.1 | Intron | XP_016861217.1 |
VGLL4 - vestigial like family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |