Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAAGCAAAAGAATGGAGCCAATTG[C/T]TATTATTATTACAGACACTGAAATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604688 MIM: 172460 MIM: 194541 | ||||||||||||||||||||
Literature Links: |
AKAP5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AKAP5 - A-kinase anchoring protein 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004857.3 | 1394 | Missense Mutation | GCT,GTT | A,V 339 | NP_004848.3 |
MTHFD1 - methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB25 - zinc finger and BTB domain containing 25 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304507.1 | 1394 | Intron | NP_001291436.1 | |||
NM_001304508.1 | 1394 | Intron | NP_001291437.1 | |||
NM_006977.3 | 1394 | Intron | NP_008908.2 | |||
XM_005268051.3 | 1394 | Intron | XP_005268108.1 | |||
XM_006720250.3 | 1394 | Intron | XP_006720313.1 | |||
XM_006720251.3 | 1394 | Intron | XP_006720314.1 | |||
XM_006720252.3 | 1394 | Intron | XP_006720315.1 | |||
XM_011537139.1 | 1394 | Intron | XP_011535441.1 | |||
XM_011537141.2 | 1394 | Intron | XP_011535443.1 | |||
XM_011537143.2 | 1394 | Intron | XP_011535445.1 | |||
XM_011537146.2 | 1394 | Intron | XP_011535448.1 | |||
XM_017021630.1 | 1394 | Intron | XP_016877119.1 | |||
XM_017021631.1 | 1394 | Intron | XP_016877120.1 | |||
XM_017021632.1 | 1394 | Intron | XP_016877121.1 | |||
XM_017021633.1 | 1394 | Intron | XP_016877122.1 | |||
XM_017021634.1 | 1394 | Intron | XP_016877123.1 | |||
XM_017021635.1 | 1394 | Intron | XP_016877124.1 | |||
XM_017021636.1 | 1394 | Intron | XP_016877125.1 | |||
XM_017021637.1 | 1394 | Intron | XP_016877126.1 | |||
XM_017021638.1 | 1394 | Intron | XP_016877127.1 |