Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTCCACATGCTCGGTCCTGCAGGC[C/T]CTGACCCTCATCATCTTCATCTGCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607888 MIM: 605658 MIM: 160710 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CMTM5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CMTM5 - CKLF like MARVEL transmembrane domain containing 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001037288.1 | 559 | Silent Mutation | GCC,GCT | A,A 43 | NP_001032365.1 | |
NM_001288744.1 | 559 | Intron | NP_001275673.1 | |||
NM_001288745.1 | 559 | Intron | NP_001275674.1 | |||
NM_001288746.1 | 559 | Silent Mutation | GCC,GCT | A,A 43 | NP_001275675.1 | |
NM_138460.2 | 559 | Silent Mutation | GCC,GCT | A,A 43 | NP_612469.1 | |
XM_017020953.1 | 559 | Silent Mutation | GCC,GCT | A,A 43 | XP_016876442.1 | |
XM_017020954.1 | 559 | Silent Mutation | GCC,GCT | A,A 43 | XP_016876443.1 |
IL25 - interleukin 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYH6 - myosin heavy chain 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |