Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAATGCTGCGAGCAGTGCCACCTCA[C/T]GGTACTCGGAGGGAGGTTGTCCGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610164 MIM: 611794 MIM: 614057 MIM: 615036 MIM: 615385 MIM: 615037 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR134 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR134 - microRNA 134 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR154 - microRNA 154 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR323B - microRNA 323b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR369 - microRNA 369 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR377 - microRNA 377 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR381HG - MIR381 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR382 - microRNA 382 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR409 - microRNA 409 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR410 - microRNA 410 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR412 - microRNA 412 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR485 - microRNA 485 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR487A - microRNA 487a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR487B - microRNA 487b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR496 - microRNA 496 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR539 - microRNA 539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR541 - microRNA 541 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR544A - microRNA 544a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR655 - microRNA 655 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR668 - microRNA 668 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR889 - microRNA 889 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |