Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCGCTGCAGCGCTTCTTCGAAGG[A/T]GAGAGACCGCGGGCTGGCGGCGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614015 MIM: 608329 | ||||||||||||||||||||
Literature Links: |
DAGLA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DAGLA - diacylglycerol lipase alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DKFZP434K028 - uncharacterized LOC26070 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYRF - myelin regulatory factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001127392.2 | Intron | NP_001120864.1 | ||||
NM_013279.3 | Intron | NP_037411.1 | ||||
XM_005274222.1 | Intron | XP_005274279.1 | ||||
XM_005274223.1 | Intron | XP_005274280.1 | ||||
XM_005274224.1 | Intron | XP_005274281.1 | ||||
XM_005274225.1 | Intron | XP_005274282.1 | ||||
XM_005274226.1 | Intron | XP_005274283.1 | ||||
XM_005274227.1 | Intron | XP_005274284.1 | ||||
XM_005274228.1 | Intron | XP_005274285.1 | ||||
XM_011545234.2 | Intron | XP_011543536.1 |