Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGATGTAGGAGTCATCACCACCGGG[C/T]GCATCGTAGGGACCCCCACCCCTCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606839 MIM: 605047 MIM: 611780 MIM: 182099 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CDHR5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CDHR5 - cadherin related family member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171968.1 | 2243 | Silent Mutation | GCA,GCG | A,A 831 | NP_001165439.1 | |
NM_021924.4 | 2243 | Silent Mutation | GCA,GCG | A,A 837 | NP_068743.2 | |
NM_031264.3 | 2243 | Silent Mutation | GCA,GCG | A,A 643 | NP_112554.2 | |
XM_006718253.3 | 2243 | Silent Mutation | GCA,GCG | A,A 757 | XP_006718316.1 | |
XM_011520188.2 | 2243 | Silent Mutation | GCA,GCG | A,A 726 | XP_011518490.1 | |
XM_011520189.2 | 2243 | Silent Mutation | GCA,GCG | A,A 695 | XP_011518491.1 | |
XM_011520190.2 | 2243 | UTR 3 | XP_011518492.1 | |||
XM_011520191.2 | 2243 | Intron | XP_011518493.1 |
IRF7 - interferon regulatory factor 7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHRF1 - PHD and ring finger domains 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCT - secretin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |