Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGAAGAGCCACGACTGCCCCTACAT[C/T]GTGCAGTGCTTTGGGACGTTCATCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612891 MIM: 603014 MIM: 605076 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LRRC8E PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LRRC8E - leucine rich repeat containing 8 family member E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP2K7 - mitogen-activated protein kinase kinase 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297555.1 | 750 | Silent Mutation | ATC,ATT | I,I 195 | NP_001284484.1 | |
NM_001297556.1 | 750 | Silent Mutation | ATC,ATT | I,I 179 | NP_001284485.1 | |
NM_145185.3 | 750 | Silent Mutation | ATC,ATT | I,I 179 | NP_660186.1 | |
XM_006722800.2 | 750 | Silent Mutation | ATC,ATT | I,I 195 | XP_006722863.1 |
SNAPC2 - small nuclear RNA activating complex polypeptide 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TGFBR3L - transforming growth factor beta receptor 3 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |