Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTCGGGCTTAAGATGAGTAAGA[C/T]GATGAGGGTAGCGTGCCAAGCAGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
17 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611275 MIM: 604684 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BNIPL PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BNIPL - BCL2 interacting protein like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C1orf56 - chromosome 1 open reading frame 56 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017860.3 | 1959 | Intron | NP_060330.2 |
CDC42SE1 - CDC42 small effector 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001038707.1 | 1959 | UTR 3 | NP_001033796.1 | |||
NM_020239.3 | 1959 | UTR 3 | NP_064624.1 | |||
XM_017001847.1 | 1959 | UTR 3 | XP_016857336.1 |
MLLT11 - myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |