Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGCCTCAGCCGGCTGCAGATAAA[C/T]GTTCAAGCTCTGGTCAGCCGACAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
19 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 103180 MIM: 611859 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARF1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARF1 - ADP ribosylation factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C1orf35 - chromosome 1 open reading frame 35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL55 - mitochondrial ribosomal protein L55 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321284.1 | Intron | NP_001308213.1 | ||||
NM_181441.2 | Intron | NP_852106.1 | ||||
NM_181454.2 | Intron | NP_852119.1 | ||||
NM_181455.2 | Intron | NP_852120.1 | ||||
NM_181456.2 | Intron | NP_852121.1 | ||||
NM_181462.2 | Intron | NP_852127.2 | ||||
NM_181463.2 | Intron | NP_852128.1 | ||||
NM_181464.2 | Intron | NP_852129.1 | ||||
NM_181465.2 | Intron | NP_852130.1 | ||||
XM_005273059.3 | Intron | XP_005273116.1 | ||||
XM_005273061.4 | Intron | XP_005273118.1 | ||||
XM_005273062.3 | Intron | XP_005273119.1 | ||||
XM_005273063.4 | Intron | XP_005273120.1 | ||||
XM_011544094.2 | Intron | XP_011542396.1 | ||||
XM_011544095.2 | Intron | XP_011542397.1 |