Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACTGAGTTCACTGTGGGATGTGA[A/C]AAGCCACTTCCCAAATCAGTGCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 157660 MIM: 604964 | ||||||||||||||||||||
Literature Links: |
ARHGEF39 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGEF39 - Rho guanine nucleotide exchange factor 39 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032818.2 | 3605 | UTR 3 | NP_116207.2 | |||
XM_011518057.2 | 3605 | Intron | XP_011516359.1 | |||
XM_017015225.1 | 3605 | Intron | XP_016870714.1 | |||
XM_017015226.1 | 3605 | Intron | XP_016870715.1 | |||
XM_017015227.1 | 3605 | Intron | XP_016870716.1 | |||
XM_017015228.1 | 3605 | Intron | XP_016870717.1 |
CCDC107 - coiled-coil domain containing 107 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195200.1 | 3605 | Intron | NP_001182129.1 | |||
NM_001195201.1 | 3605 | Intron | NP_001182130.1 | |||
NM_001195217.1 | 3605 | Intron | NP_001182146.1 | |||
NM_174923.2 | 3605 | Intron | NP_777583.2 | |||
XM_005251403.4 | 3605 | Intron | XP_005251460.1 |
RMRP - RNA component of mitochondrial RNA processing endoribonuclease | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIT1 - signaling threshold regulating transmembrane adaptor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |