Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCTACGGGGGTGAGGGGGACAATG[C/G]GGGAGGGTCAGTCTCAGGTCTTTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609585 MIM: 606912 MIM: 613472 | ||||||||||||||||||||
Literature Links: |
CPLX3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CPLX3 - complexin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6882 - microRNA 6882 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAMP2 - secretory carrier membrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ULK3 - unc-51 like kinase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099436.3 | Intron | NP_001092906.3 | ||||
NM_001284364.2 | Intron | NP_001271293.2 | ||||
NM_001284365.2 | Intron | NP_001271294.1 | ||||
XM_005254289.2 | Intron | XP_005254346.1 | ||||
XM_017022068.1 | Intron | XP_016877557.1 | ||||
XM_017022069.1 | Intron | XP_016877558.1 | ||||
XM_017022070.1 | Intron | XP_016877559.1 | ||||
XM_017022071.1 | Intron | XP_016877560.1 | ||||
XM_017022072.1 | Intron | XP_016877561.1 |