Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGGAGAAGATGCTGGGGGGTGGGG[A/G]ACCAGAACCCAGAGGAGGACCCCCG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 182100 MIM: 610349 MIM: 609623 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FUT2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FUT2 - fucosyltransferase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105447645 - uncharacterized LOC105447645 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAMSTR - MEF2 activating motif and SAP domain containing transcriptional regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130915.1 | 1995 | Missense Mutation | CCC,TCC | P,S 389 | NP_001124387.1 | |
NM_001297753.1 | 1995 | Missense Mutation | CCC,TCC | P,S 221 | NP_001284682.1 | |
NM_182574.2 | 1995 | Missense Mutation | CCC,TCC | P,S 286 | NP_872380.1 | |
XM_011526807.2 | 1995 | Missense Mutation | CCC,TCC | P,S 286 | XP_011525109.1 | |
XM_011526808.2 | 1995 | Missense Mutation | CCC,TCC | P,S 452 | XP_011525110.1 | |
XM_011526809.2 | 1995 | Missense Mutation | CCC,TCC | P,S 221 | XP_011525111.1 | |
XM_017026640.1 | 1995 | Missense Mutation | CCC,TCC | P,S 470 | XP_016882129.1 | |
XM_017026641.1 | 1995 | Missense Mutation | CCC,TCC | P,S 457 | XP_016882130.1 | |
XM_017026642.1 | 1995 | Intron | XP_016882131.1 | |||
XM_017026643.1 | 1995 | Missense Mutation | CCC,TCC | P,S 417 | XP_016882132.1 | |
XM_017026644.1 | 1995 | Missense Mutation | CCC,TCC | P,S 407 | XP_016882133.1 | |
XM_017026645.1 | 1995 | Missense Mutation | CCC,TCC | P,S 221 | XP_016882134.1 |
RASIP1 - Ras interacting protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |