Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCACAGGACTGAAGTAGAGAACCA[C/T]AAAGACTTGCTGCTGAGGGTTCAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614137 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM26D PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM26D - family with sequence similarity 26 member D | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256887.2 | Intron | NP_001243816.1 | ||||
NM_001256888.2 | Intron | NP_001243817.1 | ||||
NM_001256889.2 | Intron | NP_001243818.1 | ||||
NM_153036.4 | Intron | NP_694581.1 | ||||
XM_005266860.3 | Intron | XP_005266917.1 | ||||
XM_011535560.2 | Intron | XP_011533862.1 | ||||
XM_011535561.2 | Intron | XP_011533863.1 | ||||
XM_011535562.2 | Intron | XP_011533864.1 | ||||
XM_011535563.2 | Intron | XP_011533865.1 | ||||
XM_011535564.1 | Intron | XP_011533866.1 | ||||
XM_017010390.1 | Intron | XP_016865879.1 | ||||
XM_017010391.1 | Intron | XP_016865880.1 | ||||
XM_017010392.1 | Intron | XP_016865881.1 |
FAM26E - family with sequence similarity 26 member E | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRAPPC3L - trafficking protein particle complex 3 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001139444.2 | Intron | NP_001132916.1 |