Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATTCTTACATTTTTCTGTCTTTCT[A/G]AAAGTGTAGTGGTTATGGCTAAAGA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 605133 MIM: 611671 MIM: 612845 | |||||||||||||||||||||||
Literature Links: |
NCBP2 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
NCBP2 - nuclear cap binding protein subunit 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042540.1 | 706 | UTR 3 | NP_001036005.1 | |||
NM_001308036.1 | 706 | UTR 3 | NP_001294965.1 | |||
NM_007362.3 | 706 | UTR 3 | NP_031388.2 | |||
XM_011512556.2 | 706 | UTR 3 | XP_011510858.1 | |||
XM_011512557.2 | 706 | UTR 3 | XP_011510859.1 | |||
XM_011512558.2 | 706 | UTR 3 | XP_011510860.1 |
NCBP2-AS2 - NCBP2 antisense RNA 2 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PIGZ - phosphatidylinositol glycan anchor biosynthesis class Z | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SENP5 - SUMO1/sentrin specific peptidase 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |