Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAAGGAAGGAGAGGAAGCAATGC[C/T]AGAGATGAGCCAGATATCTGGCCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604661 MIM: 604039 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KCNIP2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KCNIP2 - potassium voltage-gated channel interacting protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014591.4 | 1574 | UTR 3 | NP_055406.2 | |||
NM_173191.2 | 1574 | UTR 3 | NP_775283.1 | |||
NM_173192.2 | 1574 | UTR 3 | NP_775284.1 | |||
NM_173193.2 | 1574 | UTR 3 | NP_775285.1 | |||
NM_173194.2 | 1574 | UTR 3 | NP_775286.1 | |||
NM_173195.2 | 1574 | UTR 3 | NP_775287.1 | |||
NM_173197.2 | 1574 | Intron | NP_775289.1 | |||
XM_005269729.2 | 1574 | UTR 3 | XP_005269786.1 | |||
XM_005269730.2 | 1574 | UTR 3 | XP_005269787.1 | |||
XM_006717812.2 | 1574 | UTR 3 | XP_006717875.1 | |||
XM_011539731.2 | 1574 | UTR 3 | XP_011538033.1 | |||
XM_017016161.1 | 1574 | UTR 3 | XP_016871650.1 |
KCNIP2-AS1 - KCNIP2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGEA5 - meningioma expressed antigen 5 (hyaluronidase) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |