Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTACCTTCCCCAGGCACCTGCACC[A/G]ACATGCAGCCCGCTGGGGACCACAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
26 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604266 MIM: 611460 MIM: 606040 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MEGF6 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MEGF6 - multiple EGF like domains 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TPRG1L - tumor protein p63 regulated 1-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WRAP73 - WD repeat containing, antisense to TP73 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017818.3 | 1302 | Missense Mutation | TCG,TTG | S,L 407 | NP_060288.3 | |
XM_005244754.1 | 1302 | Missense Mutation | TCG,TTG | S,L 362 | XP_005244811.1 | |
XM_017001387.1 | 1302 | Missense Mutation | TCG,TTG | S,L 400 | XP_016856876.1 |