Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGGATTTACAACACTTGATTATC[C/G]AGGAATGGATTAACTGATGACCAGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
16 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 600063 MIM: 610667 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SCARNA18B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SCARNA18B - small Cajal body-specific RNA 18B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TROVE2 - TROVE domain family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042369.2 | Intron | NP_001035828.1 | ||||
NM_001042370.2 | Intron | NP_001035829.2 | ||||
NM_001173524.1 | Intron | NP_001166995.1 | ||||
NM_001173525.1 | Intron | NP_001166996.1 | ||||
NM_004600.5 | Intron | NP_004591.2 | ||||
XM_006711495.3 | Intron | XP_006711558.1 | ||||
XM_006711496.3 | Intron | XP_006711559.1 | ||||
XM_006711497.3 | Intron | XP_006711560.1 | ||||
XM_011509922.2 | Intron | XP_011508224.1 | ||||
XM_017002180.1 | Intron | XP_016857669.1 | ||||
XM_017002181.1 | Intron | XP_016857670.1 | ||||
XM_017002182.1 | Intron | XP_016857671.1 | ||||
XM_017002183.1 | Intron | XP_016857672.1 |
UCHL5 - ubiquitin C-terminal hydrolase L5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |