Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAGCTGCCCCGGGACATGAGGAA[A/G]GGAACAAGGGAAAGAGCCGGTGAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 116900 MIM: 610595 MIM: 600560 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CKS1B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CKS1B - CDC28 protein kinase regulatory subunit 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FLAD1 - flavin adenine dinucleotide synthetase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001184891.1 | 64 | UTR 5 | NP_001171820.1 | |||
NM_001184892.1 | 64 | UTR 5 | NP_001171821.1 | |||
NM_025207.4 | 64 | UTR 5 | NP_079483.3 | |||
NM_201398.2 | 64 | UTR 5 | NP_958800.1 |
MIR4258 - microRNA 4258 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SHC1 - SHC adaptor protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |