Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTATTGGGGATCCCGGAGCGCCCCC[C/G]GCAGGCCAGCCACTCCGTCCAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610331 MIM: 603426 | ||||||||||||||||||||
Literature Links: |
HES6 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HES6 - hes family bHLH transcription factor 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142853.2 | 702 | Silent Mutation | GCC,GCG | A,A 161 | NP_001136325.1 | |
NM_001282434.1 | 702 | UTR 3 | NP_001269363.1 | |||
NM_018645.5 | 702 | Silent Mutation | GCC,GCG | A,A 163 | NP_061115.2 |
LOC101927958 - uncharacterized LOC101927958 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC151174 - uncharacterized LOC151174 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC643387 - TAR DNA binding protein pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PER2 - period circadian clock 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |