Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTTTTTTTACAGTGTACATATATA[G/T]AAATTGATCAAGTTCCTGAAACATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605228 MIM: 614967 | ||||||||||||||||||||
Literature Links: |
CIR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CIR1 - corepressor interacting with RBPJ, 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCRN3 - secernin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001193528.1 | 1267 | Nonsense Mutation | GAA,TAA | E,* 51 | NP_001180457.1 | |
NM_024583.4 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | NP_078859.2 | |
XM_005246853.2 | 1267 | Nonsense Mutation | GAA,TAA | E,* 78 | XP_005246910.1 | |
XM_005246854.4 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_005246911.1 | |
XM_005246855.2 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_005246912.1 | |
XM_005246856.2 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_005246913.1 | |
XM_005246857.2 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_005246914.1 | |
XM_011511839.2 | 1267 | UTR 5 | XP_011510141.1 | |||
XM_017004909.1 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_016860398.1 | |
XM_017004910.1 | 1267 | Nonsense Mutation | GAA,TAA | E,* 58 | XP_016860399.1 |