Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGTCCTTCATCAAAATCCCTGCA[C/T]GCCTGGCTGCTCATTGCCTCCTTGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC105372633 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LOC105372633 - uncharacterized LOC105372633 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MKRN7P - makorin ring finger protein 7, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF334 - zinc finger protein 334 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001270497.1 | 5208 | Intron | NP_001257426.1 | |||
NM_018102.4 | 5208 | Intron | NP_060572.3 | |||
XM_011528892.2 | 5208 | Intron | XP_011527194.1 | |||
XM_011528895.2 | 5208 | Intron | XP_011527197.1 | |||
XM_011528897.2 | 5208 | Intron | XP_011527199.1 | |||
XM_017027933.1 | 5208 | Intron | XP_016883422.1 | |||
XM_017027934.1 | 5208 | Intron | XP_016883423.1 | |||
XM_017027935.1 | 5208 | Intron | XP_016883424.1 | |||
XM_017027936.1 | 5208 | Intron | XP_016883425.1 | |||
XM_017027937.1 | 5208 | Intron | XP_016883426.1 | |||
XM_017027938.1 | 5208 | Intron | XP_016883427.1 | |||
XM_017027939.1 | 5208 | Intron | XP_016883428.1 | |||
XM_017027940.1 | 5208 | Intron | XP_016883429.1 | |||
XM_017027941.1 | 5208 | Intron | XP_016883430.1 | |||
XM_017027942.1 | 5208 | Intron | XP_016883431.1 | |||
XM_017027943.1 | 5208 | Intron | XP_016883432.1 | |||
XM_017027944.1 | 5208 | UTR 3 | XP_016883433.1 |
ZNF663P - zinc finger protein 663, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |