Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATAAACTGTCCAAATTTGAGTCA[C/T]ATTTCTCATTTCAATCACAAGAAAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603648 MIM: 610415 MIM: 604701 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
COX11 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
COX11 - COX11, cytochrome c oxidase copper chaperone | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001162861.2 | Intron | NP_001156333.1 | ||||
NM_001162862.2 | Intron | NP_001156334.1 | ||||
NM_001321518.1 | Intron | NP_001308447.1 | ||||
NM_004375.4 | Intron | NP_004366.1 | ||||
XM_011524342.2 | Intron | XP_011522644.1 | ||||
XM_017024192.1 | Intron | XP_016879681.1 | ||||
XM_017024193.1 | Intron | XP_016879682.1 | ||||
XM_017024194.1 | Intron | XP_016879683.1 | ||||
XM_017024195.1 | Intron | XP_016879684.1 | ||||
XM_017024196.1 | Intron | XP_016879685.1 |
STXBP4 - syntaxin binding protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOM1L1 - target of myb1 like 1 membrane trafficking protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321173.1 | Intron | NP_001308102.1 | ||||
NM_001321174.1 | Intron | NP_001308103.1 | ||||
NM_001321175.1 | Intron | NP_001308104.1 | ||||
NM_001321176.1 | Intron | NP_001308105.1 | ||||
NM_005486.2 | Intron | NP_005477.2 | ||||
XM_017024002.1 | Intron | XP_016879491.1 |